• Zou Group

  • Nav
  • Contact
  • Home
  • Research
  • Publications
  • Team
  • Software
  • Classes
  • Blog
Zou Group – Zou Group @Stanford

Sprout

SPROUT

SPROUT

SPROUT is a machine learning algorithm that predicts the DNA repair outcome in CRISPR-CAS9 experiments.
Click to access the source code.

Input the 20-nucleotide sgRNA sequence followed by the 3-nucleotide PAM sequence
(e.g., CCACCAAAGTACGATGTGAGAGG)


Input:


Output:



About Our Lab

We work on a wide range of machine learning problems that are motivated by challenges from modeling messy data in the wild. We develop new algorithms and theories in deep learning, unsupervised learning, robust ML, adaptive data analysis, etc. We are also very interested in applications in genomics, health and biotech. Our group is affiliated with Biomedical Data Science, CS and EE at Stanford and is a part of the Chan-Zuckerberg Biohub.